question archive A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’
Subject:BiologyPrice:2.87 Bought8
A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’.
A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector.
5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’
3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’
Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band) in which dideoxyC had been added to the growing strand?
Purchased 8 times