Exercise 15: DNA, Genes, Chromosomes and Cancer As a genetic counselor, it is often your role to explain the background of various diseases to patients

Subject:SociologyPrice:18.89 Bought3

Share With

Exercise 15: DNA, Genes, Chromosomes and Cancer As a genetic counselor, it is often your role to explain the background of various diseases to patients. You have just met a new patient who has been diagnosed with breast cancer, and it will be your responsibility to explain to her the role that DNA, genes and chromosomes may have played in her disease. You will use what you learn in this exercise to explain these concepts. Introduction The genome of an organism contains the biological information needed to construct and maintain the organism. The genomes of living cells are made of a molecule called deoxyribonucleic acid (DNA). You have already seen in the previous lab how a DNA molecule is constructed of smaller monomer units known as nucleotides, and how the sequence of nucleotides can be used to establish the unique identity of an individual. In this exercise you will investigate how the DNA molecule that comprises the genes of a person can be connected to diseases such as cancer. The genome of an organism is divided into a set of DNA molecules, each of which is packaged in a structure we call a chromosome. In humans, there are a total of 46 chromosomes, while other organisms have different numbers of chromosomes. There does not appear to be any relationship between the number of chromosomes, and the biological features of the organism. For example, both fruit flies and butterflies are insects, but the fruit fly has 8 chromosomes, while the butterfly can have 58 or more. The number of chromosomes does not appear to be linked to the size of the genome either; organisms with genomes much larger than that of humans can have half the number of chromosomes. The differences in genome size seem to reflect differences in evolutionary pathways of the organisms rather than telling us anything specific about the genomes themselves. Figure 1: DNA molecules form chromosomes The average human chromosome contains a DNA molecule that is much longer than its own length (the average DNA molecule is about 5 cm long). So there must be a very organized way of packing a DNA molecule into its chromosome. In the eukaryotic cell nucleus, the DNA wraps around structural proteins called histones to form a complex of DNA and protein known as chromatin. Chromatin can further condense into high-density packages that ultimately form the highly compact chromosome structures that can actually be seen with a light microscope during mitosis. Page 1 Ex 15: DNA, Genes, Chromosomes & Cancer “p” arm centromere “q” arm Stained bands Figure 2: Chromosome Structure with stained bands Each chromosome contains a specific size piece of DNA, has a specific physical arrangement and is identified by a number. Human chromosome 4, for example, is made up of 191 million DNA base pairs. Each chromosome is physically divided into two arms, the shorter one called the “p” arm (from the French word petit, meaning small) and the longer one called the “q” arm. Separating the two arms is a region called the centromere, which plays a role in cell division. It is at the centromere that a pair of duplicated chromosomes known as sister chromatids will be joined, and that spindle fibers used in mitosis will be attached. The centromere typically consists of large areas of repetitive DNA sequences that do not code for proteins Page 2 Ex 15: DNA, Genes, Chromosomes & Cancer To help identify different chromosomes, a procedure known as chromosome banding can be performed. In this procedure the chromosomes are stained so that they can be seen more easily. Common stains used include Giemsa, which stains the phosphate groups of DNA, and Quinacrine, which binds to adenine-thymine rich regions of the molecule. Chromosome banding makes it possible to differentiate between the chromosomes, and to help identify chromosomal abnormalities such as broken chromosomes. Along the length of each chromosome it is possible to locate the positions of genes that code for different characteristics or traits in an organism. The location or “address” of a particular gene is made up of a combination of letters and numbers that specify the position including: The chromosome on which the gene is found (in humans, 1 through 22, and X or Y ) The arm of the chromosome ( “p” or “q”) The position of the gene on the “p” or “q” arm with reference to the stained bands; the closer to the centromere, the lower the number. For example, 4q17 would represent gene position 17 on the long arm of chromosome 4. The gene located at 4q17 is closer to the centromere than 4q18. All diagrams are courtesy of the U.S. Department of Energy Genome Management Information System http://genomics.energy.gov In this way, a specific gene can be uniquely located on a chromosome, and a genetic map of each chromosome can be produced. Activity 1: Extraction of DNA DNA is present in the cells of all living organisms, but due to the small diameter of the molecule, it is not easily visible. But the reality is that there is a lot of DNA in every cell, and it can be extracted and visualized using materials that are available in your kitchen. In this part of the exercise, you will extract DNA from dried peas, and visualize it in a test tube. The first part of the extraction will be done by the instructor for the entire class, and then each person in the class will have the opportunity to do the final DNA extraction. 1. Add the following to a blender: a. About ½ a cup of split peas (about 100 ml) b. 1/8 teaspoon of table salt c. 1 cup of cold water (about 200 ml) 2. Blend the mixture on high for about 10 seconds. Do not blend longer than this, as it will break up the DNA molecules into small fragments that will be difficult to see. 3. Strain this mixture into another container through a mesh strainer. 4. Add about 30 ml of liquid detergent to the mixture and gently swirl to mix. DO NOT STIR. 5. Let the mixture sit at room temperature for 5-10 minutes. 6. Distribute approximately 5 ml into a series of test tubes, 1 per student. Page 3 Ex 15: DNA, Genes, Chromosomes & Cancer Once each student has a tube containing the extract, the remaining steps should be done by each student: 7. Add a pinch of meat tenderizer to the tube and mix gently by tapping the side of the tube. 8. Tilt the test tube and SLOWLY add 1 plastic pipette full (about 2 ml) of 91% isopropyl alcohol to the tube; the liquid should be added slowly down the side of the tube so that it forms a layer on top of the mixture. DO NOT ADD ALL OF THE ALCOHOL AT ONCE SO THAT IT MIXES WITH THE BOTTOM LAYER. 9. Let the tube sit for several minutes. You should see a separation start to occur at the interface between the water layer and the alcohol layer. The DNA will appear as a white, stringy fiber. 10. Use a long cotton tipped swab to slowly pull the long threads from the interface of the water and alcohol layers. 11. Answer the questions on the Skill Check worksheet. Activity 2: DNA, Genes, Chromosomes and Cancer In this activity you will act as a genetic counselor for a patient who has just found out she has breast cancer. Go to the web site at http://www.insidecancer.org/ and work through the exercises there to develop a strategy to answer the following questions for her. Once you have your answers to the questions find a partner and role play as if one of you is the counselor and one of you is the patient. Do this for the first question, then reverse roles and cover the second question. When you are acting as the patient, did you have all of your questions answered? Question 1: My doctor told me that I have breast cancer, but no one in my family has ever had breast cancer? Why did I get it? I thought that breast cancer was inherited. She told me that it is due to changes in my genes, but I don’t understand how changes in my genes can cause cancer. Question 2: My doctor told me that my tumor makes a high level of Her-2 proteins and that she is going to treat me with a drug called Herceptin®. How does this drug work? My friend had her cancer treated with tamoxifen, and it seems to be working for her. Why can’t I be treated with the same drug? Page 4 Ex 15: DNA, Genes, Chromosomes & Cancer Page 5 Ex 15: DNA, Genes, Chromosomes & Cancer Here’s what you’ll need… Just about everyone has heard of DNA, but do you know that it is possible to isolate DNA with things you probably have in your kitchen? Dry split peas, table salt, water, dishwashing detergent, meat tenderizer, 91% isopropyl rubbing alcohol, a blender and a strainer Ready, set, let’s isolate some DNA… Add the following to a blender -Approximately half a cup of dry split peas -A large pinch of table salt (about 1/8 teaspoon) -About 1 cup of COLD water Pulse the blender at high speed for about 10 seconds; do not over blend or the DNA will be fragmented Pour through a strainer into another container Add about 2 tablespoons of dishwashing detergent; swirl gently to mix…DO NOT STIR. Let sit for 5-10 minutes. Pour a small amount (~ 5 mls) into a small tube Now here’s where you come in… -Add a pinch of meat tenderizer to the tube and mix the tube gently -Tilt the tube to the side and slowly add a pipette full of isopropyl rubbing alcohol…add the alcohol slowly down the side of the tube so that it forms a layer on top of the original mixture…DO NOT ADD THE ALCOHOL ALL AT ONCE -In a few minutes you should notice a white substance floating above the original green material -This white stringy fiber is the DNA! Use a hook to gently loop the DNA; if it is difficult to remove, carefully press it to the side and pull it up the side of the container. Place the DNA in a small container filled with isopropyl alcohol and cap tightly! DNA can be isolated from many fruits and vegetables...give it a try at home! ©2014 Kathryn M Nette Exercise 14: DNA, It’s All in Our Genes From the AP Newswire El Cajon police today announced the death of Dr. Dinah Soares, Professor of Palentology at Cuyamaca College. Dr. Soares was found dead at approximately 10AM one week ago when her laboratory technician, Mr. Sal A. Mander, found her body in the greenhouse behind the Science & Technology building on campus. Police indicated that she had been stabbed repeatedly with a small rock pick that she used in her fossil excavation work. Dr. Soares had returned to Cuyamaca late in August from an eight month sabbatical project during which time she had been working on excavating the skeleton of a new dinosaur that appeared to have characteristics of both birds and dinosaurs. She had spent most of the semester teaching several biology classes along with writing two papers that described her latest fossil find. The Murder Weapon Police are investigating the apparent murder and will be calling on the Cuyamaca College Forensics Investigation Team to assist with the analysis of evidence. Preliminary Police Investigation Report Police began the investigation by questioning Dr. Soares’ lab technician Mr. Sal A. Mander. Mr. Mander indicated that he had arrived at work that morning at about 8AM, and had been preparing for the day’s work. He went out to the greenhouse to obtain some specimens that had been stored there, and upon opening the doors, found the body of Dr. Soares. He immediately contacted the campus police who called paramedics. Mr. Mander indicated that it was clear to him that she was already dead and probably had been for at least a few hours. When asked if he knew of any possible people who would have had a motive to kill her, Mr. Mander indicated that she had been in a significant battle with another paleontologist, Dr. Pete Moss, over the last fossil that had been discovered. Dr. Moss was insisting that his son, Forest Moss, had discovered the fossil several months earlier but had not had time to begin excavating it. Mr. Mander indicated that they had no reason to believe that was the case, and that a number of other paleontologists had had similar run-ins with Pete Moss and his son. They had been forced to retract several papers they had published because they had falsified information, and since then, they had become desperate to “redeem themselves” in the eyes of the scientific community. When Dr. Pete Moss and his son Forest Moss were questioned by police, they denied having had any issues with Dr, Soares. In fact, Forest Moss indicated that he had never met Dr. Soares, and his father confirmed that was indeed the case. The department dean, Dr. Justin Case indicated that most of the students at the college really liked Dr. Soares as an instructor, and that many of them were working with her on her research projects. One student, however, Mr. Bud Wieser, had been having problems with Dr. Soares this semester, and had threatened her in front of several witnesses. He was distraught over some low grades that he had received and wanted her to change the grades. When she told him that his grades could not be changed, he stormed out, muttering that he would somehow get back at her. Police questioned the student, Mr. Bud Wieser, who denied that he had been serious about threatening Dr. Soares, and was just angry that she had promised him a position on her next excavation team, but had then denied him the position because of low grades he had earned in one of her classes. He said she claimed it was because he did not know enough to go on the excavation, but he believed that she simply did not like him. The forensic team investigating the crime scene for evidence found the murder weapon next to the body. There were no fingerprints on the weapon, but it was covered with blood, a sample of which was sent to the Cuyamaca Crime Lab for analysis. In addition, a sample of Dr. Soares’ blood was sent to the lab. Further investigation of the area inside the greenhouse revealed a broken pane of glass in the greenhouse wall, and several trays of samples that appeared to have been knocked over. Examination of the glass by investigators revealed a small amount of blood was present, and the blood was of a different type than that of Dr. Soares. A sample of this blood was sent to the lab for analysis. Investigators have obtained blood samples from suspects Dr. Pete Moss, Forest Moss and Bud Wieser for analysis along with the other blood samples. Important Safety Information Wear gloves while opening and handling the gel since it contains ethidium bromide which can damage DNA. In addition, when you are finished with the gel, be sure to dispose of it in the container provided in the laboratory. DO NOT THROW THE GEL INTO THE REGULAR TRASH as it is hazardous waste! Be sure to wear your safety glasses while you are working with the chemicals from this lab, and while you are viewing the gel on the UV light box. UV light can damage your eyes if they are not protected! Activity 1: Preparation of Forensic Samples For this lab exercise, it will be your job as part of Cuyamaca’s Forensics Investigation Team to determine if there is sufficient evidence to charge one of the police department’s suspects with murder. The first parts of the procedure for a have already been completed by another part of the Cuyamaca forensics team. It will be your responsibility to run the final gel electrophoresis analysis to determine whether the sample from any of the suspects matches the blood sample found at the crime scene. The following samples and standards are available to be tested: Standard: A HindIII DNA digest to be used as the size standard CS: This is the sample from the crime scene. S1: Suspect 1: Dr. Pete Moss S2: Suspect 2: Dr. Forest Moss S3: Suspect 3: Mr. Bud Wieser S4: This is a blood sample from the victim, Dr. Dinah Soares Each of the crime scene, suspect and the victim samples has already been prepared for analysis by the Cuyamaca Forensics Investigation Team using the following procedure: 1) Each blood sample was amplified using PCR (Polymerase Chain Reaction) to obtain sufficient DNA for forensic analysis. 2) Ten microliters of each of the five samples was added to a clean tube and the tubes were labeled according to the list shown above. 3) To each tube, 10 µl of an EcoR1/Pst1 restriction enzyme mix was added. All of the tubes were then incubated at 37oC for 45 minutes. 4) The tubes were allowed to cool to room temperature, and 5 µl of loading dye was added to each tube. These samples have now been delivered to you to complete the analysis of the DNA by agarose gel electrophoresis. It will be your responsibility to set up and run the gel, and then to analyze the results in order to determine whether if any of the three suspect’s DNA matches the DNA found on the broken window at the crime scene. Activity 2: Gel Electrophoresis of Forensic Samples Preparation of Electrophoresis Gel The electrophoresis equipment you will use to separate the DNA fragments into patterns that can be compared is based on new technology that is somewhat different from the example you saw in the online demonstration. The agarose gel is already prepared for you to use, and also contains the ethidium bromide in the gel. This means that as soon as the gel has been run you will be able to view the results by placing the gel on an ultraviolet (UV) illumination box. In this lab exercise you will use the E-Gel® electrophoresis system. It consists of a precast agarose gel which already contains ethidium bromide (EtBr) and the EGel®PowerBase (Figure 1). You will be working in groups of four students to complete this exercise, and two groups will share one gel to run the electrophoresis. Each gel has a total of twelve wells and each group will use six of the wells on the gel. Figure 1: E-Gel® Precast Agarose gel and Powerbase ® In addition to the agarose E-Gel and the EGel® PowerBase, your group should also have a small tube rack holding six microcentrifuge tubes. Each tube holds one of the samples that you will load into a lane on the agarose gel. You should also have a micropipettor that is set to a 20 microliter (µl) volume for loading the samples onto the gel. Figure 2: Gel Loading Equipment and Samples Be sure you are wearing gloves, then carefully tear open the gel pouch at the indicated place (Figure 3). Figure 3: Opening E-Gel® Package Carefully remove the gel from the protective pouch being sure to hold it by the top or plastic edges only. If you touch the surface of the gel, it will damage it. (Figure 4) Figure 4: Remove E-Gel® from package Plug the PowerBase into an electrical outlet. Carefully insert the gel cassette into the PowerBase. You should insert the gel at an angle, with the right edge tabs inserted into position first, then lower the left side and gently press into place. Press firmly at the top and bottom to seat the gel in the base. Be careful to press on the plastic cassette only, not on the gel. (Figure 5) The Invitrogen logo should be at the bottom of the base. A steady red light illuminates on the base if the gel is correctly inserted. Figure 5: Inserting the gel cassette into the PowerBase Pre-run the gel with the comb in place by pressing and holding either button on the PowerBase until the red light turns to a flashing green light indicating the start of a two-minute pre-run. Release the button. At the end of the pre-run, the current automatically shuts off. (Figure 6) Figure 6: Pre-run the gel. When the pre-run is complete, gently remove the plastic comb from the wells in the gel. Be careful to pull the comb up as straight as possible so the individual wells are not damaged. (Figure 7) Figure 7: Remove the comb from the gel. Check to see that the micropipettor volume is correctly set at 20 µl. The window on the pipettor should read 020 when reading from the top down. (Figure 8) Your instructor will review the operation of the micropipettor with you. Do not continue until you are sure that you understand its correct operation. You may practice operating the micropipettor using plain tap water in a microcentrifuge tube before you actually start working with the real samples. Figure 8: Set the micropipettor volume. To place a tip onto the micropipettor, firmly push the pipettor onto a tip in the supply box. Do not touch the plastic tips with your hands as the enzymes on your hands will damage the DNA samples. (Figure 9) Figure 9: Inserting a tip on the micropipettor. Place the tip of the micropipettor into the liquid at the bottom of the sample tube. There will only be a small quantity of liquid in the tube, and you must be very careful that the pipette tip is in the liquid. Depress the plunger on the micropipettor to the first stop, and very slowly draw up the liquid into the pipettor. Figure 10: Taking a sample from a tube using micropipettor When the correct amount of liquid has been drawn into the pipette tip, withdraw the pipettor from the tube. You are now ready to load this sample into a well in the gel. Figure 11: Sample ready to load on gel Load your first sample into the first well in the gel. Insert the tip of the pipettor into the well near its top. Be sure not to put the tip all the way into the well. If you touch the bottom of the well with the tip, it may puncture a hole in the gel which will cause the gel to run incorrectly. Gently press the plunger on the micropipettor all the way to the second stop; slowly remove the tip from the well before allowing it to retract The first 6 lanes of the gel should be loaded with the following samples: Lane 1: HindII DNA standard Lane 2: CS sample Lane 3: Suspect 1 Lane 4: Suspect 2 Lane 5: Suspect 3 Lane 6: Victim sample Figure 12: Loading the gel. Once the first six lanes of the gel have been loaded, a second team should be ready to load the next six lanes of the gel. These lanes should be loaded as follows: Lane 7: HindII DNA standard Lane 8: CS sample Lane 9: Suspect 1 Lane 10: Suspect 2 Lane 11: Suspect 3 Lane 12: Victim sample If there is not another group that needs to load samples, then the remaining six lanes of the gel should each be loaded with 20 µl of deionized water. Figure 13: Gel loaded and ready to run. Once all of the wells in the gel have been loaded with either samples or water, press the 30 minute button at the top of the PowerBase. The cycle will start and run for 30 minutes and then will shut off automatically Figure 14: Starting the run. After a few minutes you should see the blue loading dye start to move down the gel. The dye front will continue to move down the gel until the run is complete. The PowerBase will shut off automatically when the run is complete and will signal the end of the run with a flashing red light and rapid beeping. Press either button to stop the beeping. Figure 15: During the run. Unplug the PowerBase and carefully remove the gel cassette. Figure 16: Removing the gel cassette Place the cassette on the UV illuminator. Be sure to wear your safety glasses before viewing the gel. Figure 17: Placing the Gel on the UV illuminator Turn on the light to the UV illuminator and view the gel. When you have completed looking at the gel, be sure to dispose of it in the appropriate container in the lab. DO NOT THROW THE GEL IN THE REGULAR TRASH! Figure 18: Viewing the final gel. Activity 3: Analysis of Forensic Samples In this activity, you will analyze the results of your get to determine if there are any two samples that appear to have the same band pattern. This would indicate that the two samples were from the same person, and that those samples that do not match were not from the same person. 1) On the Skill Check worksheet, draw a representation of the bands present on the lanes of your gel. Try to accurately depict the approximate positions and numbers of bands in each lane of the gel relative to each other. Question 1: Do you see any of the band patterns in the different lanes that appear to match each other? Which lanes? Question 2: Do any of the suspect samples appear to have recognition sites at the same location as the DNA from the crime scene? Question 3: Based on the analyses you have done, do any of the suspect samples of DNA seem to be from the same individual as the DNA from the crime scene? Describe the scientific evidence that supports your conclusion. Activity 4: Summary of Data Analysis In this activity, you will be summarizing your findings to the police department in order to determine whether they have sufficient evidence for an arrest in the case. On the Skill Check worksheet, write a summary of 3-4 paragraphs of your evidence, and who (if anyone) it points to as the alleged murderer. Be sure to discuss your electrophoresis process, how you analyzed the data, and summarize your results and conclusions. Pre-Lab Exercise 14: DNA, It’s All in Our Genes Introduction Genes are the basic units of heredity; a set of biochemical instructions that tell cells how to manufacture proteins. Genes composed of DNA (deoxyribonucleic acid), and consist of sequences of four building blocks known as bases. The four bases—adenine (A), thymine (T), cytosine (C) and guanine (G) each bond to a sugar and a phosphate group to unit called a nucleotide. The nucleotides in the DNA molecule are arranged in a sequence that, when read in of three at a time, will code for a sequence of amino acids the building blocks of a protein. These proteins are responsible for the various traits or characteristics of a cell ultimately the whole organism. The DNA molecule itself is composed of two strands, and the nucleotides bind in pairs as base pairs, A with T and G with C) to hold the two strands together. The complete set of genetic instructions, including protein coding sequences of DNA and a few other smaller of DNA that can be found in the cell comprise the organism’s genome. are form a groups that are and (known these pieces The human genome consists of nearly 3.2 billion base pairs which encode approximately 25,000 genes that make up less than 2% of the total DNA. The remainder of the DNA contains non-coding regions of different types, including regions of repeat DNA sequences that form the basis of the analytical processes we will look at in this exercise. In the last 50 years our understanding of DNA and its role in organisms has revolutionized our lives whether we realize it or not. Our ability to produce drugs like human insulin or to convict criminals of heinous crimes now centers on technology that is focused on the DNA molecules in our bodies. Uses of DNA technology has enabled us to: • • • • • • • • • Identify and protect endangered species of animals and plants Free prisoners who had been unjustly convicted of a crime Confirm the identity of human remains found in unmarked graves Determine the relatedness of ancient and modern humans Return children who had been stolen to their rightful families Prove paternity Identify disease causing microorganisms Help doctors monitor bone marrow transplants Help to solve crimes by identification of victims and suspects. Who Done It? : DNA Profiling in Forensics DNA technology has had a major impact on the field of forensics. Forensics is the use of science and technology to investigate and establish facts in legal cases. The most important application of biology to forensics is DNA profiling, the analysis of DNA fragments to determine whether the DNA came from a particular individual. You may have heard this referred to as DNA fingerprinting, the original (and more commonly known) name used for the procedure. As mentioned earlier, only 2% of the DNA in the human genome codes for proteins. Some of the remaining DNA makes up regions called satellites. Satellites are regions of repeating segments of DNA and are generally divided into two different types, minisatellites and microsatellites. Much of the human genome outside of the protein coding genes is composed of minisatellites and microsatellites. Minisatellite DNA regions are also known as VTNR’s (variable number of tandem repeats). These are areas of DNA where sequences made of 10-80 bases are repeated many times in tandem. An example of a VTNR sequence would be TTCGGGTTGG. This would be found repeated many times, generally making up a repeated sequence that is 50-1500 bases in total. A typical VTNR region of DNA might look like the following: TTCGGGTTGG TTCGGGTTGG TTCGGGTTGG TTCGGGTTGG TTCGGGTTGG Microsatellite DNA regions are also known as STR’s (short tandem repeats). STR’s are short, repeated sequences ranging from 2-10 base pairs in length. For example, the repeat ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC contains 13 copies of a four-nucleotide sequence ATCC. There are thousands of different STR locations on different chromosomes in humans, and for each location, there are many different alleles possible (i.e. STR’s made up of different numbers of repeats). Typically, STR’s have a repeat length of 2-10 bases, and the number of bases making up a tandem repeated fragment range from approximately 50-500 bases. DNA profiling relies on the fact that 1) the human genome contains many different regions of tandem repeats, and 2) the number of tandem repeats varies considerably in different people. Although the techniques of DNA profiling were originally done by analyzing VNTR’s, today it is STR regions that are typically analyzed. Although producing a DNA profile is a technique of molecular biology, interpretation of the results requires a statistical analysis of population data that is beyond the scope of this course. Because there are many different STR alleles possible at each STR location, and many people are heterozygous (have two different STR’s) at a particular location, if a number of different STR locations are analyzed the probability of the DNA of two different people matching by chance is extremely small. This can be used as evidence of guilt, rather than a coincidental similarity, although DNA evidence is often more valuable in excluding a suspect than in proving guilt. Real DNA profiling is done by analyzing 13 different STR sites in the human genome. Analysis of this many different sites greatly decreases the probability that the DNA from two different people could be matched accidentally. In the United States, a standardized set of 13 STR’s called the CODIS panel (Combined DNA Index System) is used by law enforcement and other government agencies in preparing DNA profiles. More than 3 million DNA profiles are stored, and the information in the system has allowed more than 22,000 suspects to be identified based on their DNA alone. The lab exercise that you will do this week is a much simpler simulation of the techniques that are used for DNA profiling in the real world. This week you will prepare the samples and run agarose gel electrophoresis to separate the DNA fragments. Next week you will look at your gels and analyze your data to determine the answer to the question Who Done It? So how is the typical DNA profile produced? First, DNA samples are collected from the crime scene, suspects, victims or stored evidence. It is extremely important that these samples be handled by a well documented system so that there can be no questions about the origins of the samples or the possibility of contamination by outside sources. Second, the selected STR markers from each sample are amplified (copied many times) by a process known as PCR (Polymerase Chain Reaction). When a source of DNA is scanty (there are only tiny amounts available, such as from a drop of blood), this technique allows specific areas of DNA to be targeted and quickly amplified in a test tube. Starting with a single DNA segment, the PCR method can produce billions of copies of that molecule in a few hours. Only tiny quantities of DNA are needed for this procedure, and the copies can then be analyzed. Third, it is necessary to determine if the linear base pair sequence in the different DNA samples is identical or not! In order to do that, the DNA at the different STR sites in the different samples must be cut into small fragments that can be analyzed. To accomplish this, special enzymes called restriction enzymes are used. In nature, these enzymes are produced by bacteria as a defense mechanism that will destroy DNA from invading viruses (called bacteriophage). The restriction enzymes act like tiny pairs of scissors that will cut the DNA at very specific regions of nucleotide bases known as recognition sites. This will cause the double stranded DNA molecule to become broken into two pieces. For example, given the following region of double stranded DNA and a restriction enzyme called EcoRI, ATGAATTCTCAATTACCT TACTTAAGAGTTAATGGA the dotted line through the base pairs shows the sites where the bonds will break if the restriction enzyme EcoRI recognizes the site GAATTC. The DNA fragment size can be expressed as the number of base pairs in the fragment. If we look at only a single strand of the DNA molecule, we can determine the size of the fragments that would be produced. For example, if EcoRI were used to cut the following fragment, CAGTGATCTCGAATTCGCTAGTAACGTT It would be necessary to look for GAATTC sequences in the molecule CAGTGATCTCGAATTCGCTAGTAACGTT The EcoRI would cut between the G and the first A in the sequence GAATTC, breaking the DNA into two fragments CAGTGATCTCG AATTCGCTAGTAACGTT The size of the fragments can be determined by counting the number of bases in the fragment. CAGTGATCTCG has a total of 11 bases and AATTCGCTAGTAACGTT has a total of 17 bases. Next, we will see how these fragments can be separated based on their sizes (= number of bases). Fourth, the lengths of STR sequences at the 13 sites scattered throughout the genome are compared using agarose gel electrophoresis. A comparison of the pattern of fragments between the DNA found at the murder site and the DNA of the suspects can either confirm the identity of the sample or eliminate a suspect. The DNA of each sample is cut with restriction enzymes; if two samples are from the same source, the fragment sizes will be the same and will produce the same pattern (see example below) and if the samples are from different sources, the patterns will be different. Figure 1 shows the results of agarose electrophoresis of DNA samples from three different individuals and an unknown crime scene sample. Samples of DNA are loaded in wells at the negative (-) electrode end of the gel. An electric current is applied across the gel and the DNA samples migrate through the gel from the negative toward the positive electrode. DNA fragments of different base sizes (which equates to differing numbers of copies of the same repeat) will migrate at different speeds and will move different distances. The band patterns will thus be different for people who have different number of repeats at each STR location and can be used to eliminate suspects and show which suspects were potentially at a crime scene location. Suspect 1 Suspect 2 Suspect 3 Crime Scene - - - - 5 repeats 4 repeats 6 repeats 6 repeats 4 repeats 4 repeats 3 repeats 2 repeats + + + + Figure 1: DNA Profiles: Patterns from three different suspects and Crime Scene For more information on the history of DNA profiling and some examples of how it has been used, go to the web site at https://learn.genetics.utah.edu/content/labs/gel . In the next section of this pre-lab you will go through an online exercise that will walk you through the steps of the process of electrophoresis so that you will be prepared to do an actual electrophoresis in the lab this week. Techniques of DNA Profiling: Agarose Gel Electrophoresis (Thanks to Michelle Garcia for finding this online exercise) One of the key techniques used in laboratories is agarose gel electrophoresis. This method is used in molecular biology to separate DNA molecules according to size (numbers of bases). This is achieved by moving negatively charged DNA molecules through an agarose gel matrix with an electrical field (electrophoresis). In the process, short molecules move faster and migrate farther than longer ones, allowing scientists to characterize the DNA molecules. Figure 2 below shows the typical types of DNA banding patterns that might be seen on an agarose gel. Figure 2: Agarose Gel Example In the remainder of this exercise you will learn about this process using a virtual laboratory that is found at the website http://learn.genetics.utah.edu/units/biotech/gel/. First you should read through the tutorial and will answer some basic questions. Then you will be able to virtually make and run your own gel. Read through the basic tutorial and then answer the following questions. 1. What does gel electrophoresis allow scientists to do with DNA? 2. In order to make the DNA move through the gel, what must be done to it? 3. What direction does the DNA move (+ to – or – to +) Why do you think it moves in that direction? 4. Which DNA strands will move farthest (smaller or larger strands)? Explain why. You will now virtually make and run your own gel. Please follow the 5 steps carefully and answer the corresponding questions. Step 1: Make the gel 1. List the ingredients to make a gel: 2. What is agarose made from? 3. Why does buffer have to be added to make the gel? Step 2: Set up gel apparatus 1. What do you need to set up the gel apparatus? Step 3: Load DNA into gel 1. What solutions/items are needed to load DNA into the gel? 2. Why do you need to add loading buffer to the samples (Two reasons!)? 3. Why do you need to add a DNA standard to the gel? What will it be used for? Step 4: Hook up electrical current to run gel 1. The black plug is (+ or -)? The red plug is (+ or -)? 2. Once you turn on the power supply, how do you know the current is running? Step 5: Stain gel and analyze results 1. What is the chemical used to stain the DNA in the gel? 2. How does this stain work? 3. Is this stain harmful to your DNA? Should gloves be worn when staining DNA? 4. What are the estimated sizes of the three DNA strands? What does bp stand for? Skill Check Worksheet DNA: It’s All in Our Genes NAME:_______________________ Lab Section: _________________ Activity 3: Analysis of Forensic Samples This photo is an actual photo of a gel that was run using the samples outlined in this lab. From left to right: Lane 1: A HindIII DNA digest used as the control for the size standards Lane 2: Crime scene sample Lane 3: Suspect 1: Dr .Pete Moss Lane 4: Suspect 2: Dr. Forest Moss Lane 5: Suspect 3: Mr. Bud Wieser Lane 6: Blood sample from the victim, Dr. Dinah Soares You will need to look at the bands on the gel very carefully, as some of the bands are quite faint. That does not make them any less important just because the bands may be faint. In order to make sure that you do not miss any of the bands the first thing that you should do is make a drawing in the space below; draw the band pattern in each of the lanes. Be sure to label the lanes as to their contents, and then draw the bands in proportion to their positions on the gel. Be sure to account for faint bands. Question 1: Do you see any of the band patterns in the different lanes that appear to match each other? Which lanes? Question 2: Do any of the suspect samples appear to have recognition sites at the same location as the DNA from the crime scene? Question 3: Based on the analyses you have done, do any of the suspect samples of DNA seem to be from the same individual as the DNA from the crime scene? Describe the scientific evidence that supports your conclusion. Activity 4: Summary of Data Analysis Write a summary of your evidence, and who (if anyone) it points to as the alleged murderer. Be sure to discuss your electrophoresis process, how you analyzed the data, and summarize your results and conclusions. Is this data sufficient to convict your suspect do you think? What other evidence do you think you should have to take this to court?